WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031912 Gene Name  Cbr-tsen-54
Sequence Name  ? CBG10548 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: tRNA-splicing endonuclease, subunit Sen54; tRNA-splicing endonuclease, subunit Sen54, N-terminal; and tRNA-splicing endonuclease subunit sen54 N-term. Is an ortholog of C. elegans tsen-54. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10548a.1 CBG10548a.1   [unknown]
Transcript:CBG10548b.1 CBG10548b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10548a CBG10548a   [unknown]
CDS:CBG10548b CBG10548b   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00115907
WBVar00115908

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG10548, CGCCACGTGGAACAGGAGATAAAACAGAAATTCGCAGAGAAGACGTTCGATTTGCTGGTC, WBGene00031912   Expr1057942 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term