WormMine: Gene WBGene00031546

• WormBase Gene ID: WBGene00031546
• Gene Name: Cbr-clu-1
• Sequence Name: CBG10067
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Clustered mitochondria protein, N-terminal; Mitochondrial function, CLU-N-term; GSKIP domain superfamily; Tetratricopeptide-like helical domain superfamily; CLU domain; CLU central domain; GSKIP domain; Translation initiation factor eIF3 subunit 135; and Clustered mitochondria. Is an ortholog of C. elegans clu-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10067.1	CBG10067.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10067	CBG10067		[unknown]

0 RNAi Result

6 Allele

• WBVar00115545
• WBVar00115546
• WBVar00115547
• WBVar00115542
• WBVar00115543
• WBVar00115544

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1063476
• Remark: Cbr-clu-1, TCTCGTTGCGGAGAAAGAGACGTCCAGCATTTATACTGAGCTGTATGGAAAGAATCATCA, WBGene00031546
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term