WormMine: Gene WBGene00031349

• WormBase Gene ID: WBGene00031349
• Gene Name: Cbr-ssq-2
• Sequence Name: CBG09831
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans ssq-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09831c.1	CBG09831c.1		[unknown]
Transcript:CBG09831b.1	CBG09831b.1		[unknown]
Transcript:CBG09831a.1	CBG09831a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09831c	CBG09831c		[unknown]
CDS:CBG09831a	CBG09831a		[unknown]
CDS:CBG09831b	CBG09831b		[unknown]

0 RNAi Result

6 Allele

• WBVar00115329
• WBVar00115325
• WBVar00115326
• WBVar00115327
• WBVar00115328
• WBVar00115324

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066420
• Remark: Cbr-ssq-2, AAGAGGAGCTTCCACTATGACAGCTGTTGGAGGAGCCCCAGCAGGAGGACCAAGCACCAT, WBGene00031349
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term