WormMine: Gene WBGene00031195

• WormBase Gene ID: WBGene00031195
• Gene Name: CBG09637
• Sequence Name: CBG09637
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Protein of unknown function DUF229. Is an ortholog of C. elegans F32G8.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09637.1	CBG09637.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09637	CBG09637		[unknown]

0 RNAi Result

9 Allele

• WBVar00115037
• WBVar00115038
• WBVar00115039
• WBVar00115040
• WBVar00115041
• WBVar00115042
• WBVar00115043
• WBVar00115044
• WBVar00115045

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050572
• Remark: CBG09637, TCACCACATTTTTCTCTGGACCTCAACAAATTCGAGACTTAATTGATGTAGATTATGACA, WBGene00031195
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term