WormMine: Gene WBGene00032416

• WormBase Gene ID: WBGene00032416
• Gene Name: CBG11275
• Sequence Name: CBG11275
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domain: Chondroitin proteoglycan 3. Is an ortholog of C. elegans F52E1.5. In C. elegans, F52E1.5 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11275.1	CBG11275.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11275	CBG11275		[unknown]

0 RNAi Result

1 Allele

• WBVar00116759

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1054198
• Remark: CBG11275, AAACAAAGTGTACACAAGACACTGATAACTGCTACGGGCTGCCTTGTCGTGTTGGAAGAT, WBGene00032416
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term