WormMine: Gene WBGene00032203

• WormBase Gene ID: WBGene00032203
• Gene Name: Cbr-lam-2
• Sequence Name: CBG10982
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Galactose-binding-like domain superfamily; EGF-like domain; Laminin B (Domain IV); Laminin EGF domain; Laminin-type EGF domain; Laminin N-terminal (Domain VI); Laminin IV; and Laminin, N-terminal. Is an ortholog of C. elegans lam-2. In C. elegans, lam-2 is involved in positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10982.1	CBG10982.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10982	CBG10982		[unknown]

0 RNAi Result

1 Allele

• WBVar00116346

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051024
• Remark: Cbr-lam-2, TGAAAAAATTGTGGACTCTGTCACCAACGCTGATAAGACTCTGAAGGACGCCGAAGCAGT, WBGene00032203
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term