WormMine: Gene WBGene00032213

• WormBase Gene ID: WBGene00032213
• Gene Name: Cbr-syd-9
• Sequence Name: CBG10997
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans syd-9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10997b.1	CBG10997b.1		[unknown]
Transcript:CBG10997a.1	CBG10997a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10997a	CBG10997a		[unknown]
CDS:CBG10997b	CBG10997b		[unknown]

0 RNAi Result

18 Allele

• WBVar00116359
• WBVar00116360
• WBVar00116361
• WBVar00116366
• WBVar00116362
• WBVar00116363
• WBVar00116364
• WBVar00116365
• WBVar00116349
• WBVar00116350
• WBVar00116355
• WBVar00116356
• WBVar00116357
• WBVar00116358
• WBVar00116351
• WBVar00116352
• WBVar00116353
• WBVar00116354

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062086
• Remark: Cbr-syd-9, CATCTTCCAATCCACATGACTCTGAGCCACGGATTCCCACCACCGGCCGCTACCGTTGAC, WBGene00032213
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term