WormMine: Gene WBGene00032251

• WormBase Gene ID: WBGene00032251
• Gene Name: Cbr-unc-52
• Sequence Name: CBG11064
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin subtype; Immunoglobulin-like domain; Laminin B (Domain IV); Immunoglobulin-like fold; Laminin EGF domain; Immunoglobulin domain; LDL receptor-like superfamily; Low-density lipoprotein (LDL) receptor class A repeat; Immunoglobulin subtype 2; Laminin-type EGF domain; Low-density lipoprotein receptor domain class A; Immunoglobulin-like domain superfamily; and Laminin IV. Is an ortholog of C. elegans unc-52. In C. elegans, unc-52 is involved in several processes, including hemidesmosome assembly; muscle cell cellular homeostasis; and muscle structure development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11064e.1	CBG11064e.1		[unknown]
Transcript:CBG11064d.1	CBG11064d.1		[unknown]
Transcript:CBG11064c.1	CBG11064c.1		[unknown]
Transcript:CBG11064b.1	CBG11064b.1		[unknown]
Transcript:CBG11064a.1	CBG11064a.1		[unknown]
Transcript:CBG11064h.1	CBG11064h.1		[unknown]
Transcript:CBG11064g.1	CBG11064g.1		[unknown]
Transcript:CBG11064f.1	CBG11064f.1		[unknown]

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11064h	CBG11064h		[unknown]
CDS:CBG11064g	CBG11064g		[unknown]
CDS:CBG11064f	CBG11064f		[unknown]
CDS:CBG11064a	CBG11064a		[unknown]
CDS:CBG11064e	CBG11064e		[unknown]
CDS:CBG11064d	CBG11064d		[unknown]
CDS:CBG11064c	CBG11064c		[unknown]
CDS:CBG11064b	CBG11064b		[unknown]

0 RNAi Result

5 Allele

• WBVar00116389
• WBVar00116391
• WBVar00116390
• WBVar00012542
• WBVar00012537

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr1062347
• Remark: Cbr-unc-52, TTCAAACGAGAACTGTCCTGAACGTTGGATCCGGAAAACGCAAGCGAAAACATCTGGGGA, WBGene00032251
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1066407
• Remark: CBG11065, GTGATGGAGTAGATGACTGTGGAGATGGATCAGATGAAACAAACTGTGATTCGAATGAAG, WBGene00032252
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term