WormMine: Gene WBGene00032074

• WormBase Gene ID: WBGene00032074
• Gene Name: CBG10800
• Sequence Name: CBG10800
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Fukutin-related. Is an ortholog of C. elegans T07D3.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG10800a.1	CBG10800a.1		[unknown]
Transcript:CBG10800b.1	CBG10800b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG10800a	CBG10800a		[unknown]
CDS:CBG10800b	CBG10800b		[unknown]

0 RNAi Result

5 Allele

• WBVar00116217
• WBVar00116218
• WBVar00116219
• WBVar00116220
• WBVar00116221

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054549
• Remark: CBG10800, CGAATACGGTCCAGAATGGAGGAAAGATCATCCGTCGTCTGTTTACACATGGAATAAATC, WBGene00032074
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term