WormMine: Gene WBGene00032817

• WormBase Gene ID: WBGene00032817
• Gene Name: Cbr-mboa-6
• Sequence Name: CBG11740
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MBOAT, membrane-bound O-acyltransferase family and Membrane bound O-acyl transferase, MBOAT. Is an ortholog of C. elegans mboa-6. In C. elegans, mboa-6 is involved in glycerophospholipid biosynthetic process; positive regulation of growth rate; and post-embryonic development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11740b.1	CBG11740b.1		[unknown]
Transcript:CBG11740a.1	CBG11740a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11740a	CBG11740a		[unknown]
CDS:CBG11740b	CBG11740b		[unknown]

0 RNAi Result

19 Allele

• WBVar00117537
• WBVar00117536
• WBVar00117538
• WBVar00117529
• WBVar00117526
• WBVar00117525
• WBVar00117528
• WBVar00117527
• WBVar00117533
• WBVar00117532
• WBVar00117535
• WBVar00117534
• WBVar00117531
• WBVar00117530
• WBVar00117522
• WBVar00117521
• WBVar00117524
• WBVar00117523
• WBVar00117520

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067688
• Remark: CBG11740, GACAATTCTGGATTCCGGACAAATGGTTCAATTCGGATGCATTCTATGGACTATCATTCT, WBGene00032817
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term