WormMine: Gene WBGene00032760

• WormBase Gene ID: WBGene00032760
• Gene Name: Cbr-str-173
• Sequence Name: CBG11673
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans str-173.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11673.1	CBG11673.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11673	CBG11673		[unknown]

0 RNAi Result

6 Allele

• WBVar00117317
• WBVar00117319
• WBVar00117318
• WBVar00117320
• WBVar00117322
• WBVar00117321

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052683
• Remark: Cbr-str-173, TTTCGAAATTAATTGCCAATTTATAGCCGCACCGATCACTTTGGTTTTTGCCATGTACTC, WBGene00032760
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term