WormMine: Gene WBGene00033634

• WormBase Gene ID: WBGene00033634
• Gene Name: CBG12728
• Sequence Name: CBG12728
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Anaphase-promoting complex subunit 4, WD40 domain; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; Anaphase-promoting complex subunit 4 WD40 domain; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans F02E9.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12728.1	CBG12728.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12728	CBG12728		[unknown]

0 RNAi Result

5 Allele

• WBVar00118857
• WBVar00118856
• WBVar00118859
• WBVar00118858
• WBVar00118860

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050457
• Remark: CBG12728, TCAGTATCAAGAGTACAACCCGTACGCAGAACCACGTACTCCACCACAAGAAGAGGAAGA, WBGene00033634
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term