WormMine: Gene WBGene00032995

• WormBase Gene ID: WBGene00032995
• Gene Name: CBG11978
• Sequence Name: CBG11978
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Integral membrane protein S linking to the trans Golgi network and Integral membrane protein SYS1-related. Is an ortholog of C. elegans T03F1.12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11978.1	CBG11978.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11978	CBG11978		[unknown]

0 RNAi Result

2 Allele

• WBVar00118093
• WBVar00014252

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058559
• Remark: CBG11978, GTGGATCCTGCAAGTAATCTCGACAACAGTTTGTACAGTGCTTGGTGAATATCTTTGTAT, WBGene00032995
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term