WormMine: Gene WBGene00036041

• WormBase Gene ID: WBGene00036041
• Gene Name: Cbr-dhs-30
• Sequence Name: CBG15942
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: NAD(P)-binding domain superfamily; short chain dehydrogenase; and Short-chain dehydrogenase/reductase SDR. Is an ortholog of C. elegans dhs-30.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15942.1	CBG15942.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15942	CBG15942		[unknown]

0 RNAi Result

25 Allele

• WBVar00050079
• WBVar00050074
• WBVar00050044
• WBVar00050049
• WBVar00050034
• WBVar00050039
• WBVar00050069
• WBVar00050064
• WBVar00050054
• WBVar00050059
• WBVar00050009
• WBVar00050004
• WBVar00050024
• WBVar00050029
• WBVar00050014
• WBVar00050019
• WBVar00123460
• WBVar00123462
• WBVar00123461
• WBVar00123464
• WBVar00123463
• WBVar00123457
• WBVar00123456
• WBVar00123459
• WBVar00123458

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054397
• Remark: Cbr-dhs-30, GCAGGATATATTAACACTGGTTTCGGATCCAGAGCTATCGATCCATCTGGAAAAGTTGTT, WBGene00036041
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term