WormMine: Gene WBGene00034196

• WormBase Gene ID: WBGene00034196
• Gene Name: Cbr-che-10
• Sequence Name: CBG13429
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Ciliary rootlet component, centrosome cohesion. Is an ortholog of C. elegans che-10. In C. elegans, che-10 is involved in cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13429.1	CBG13429.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13429	CBG13429		[unknown]

0 RNAi Result

19 Allele

• WBVar00119749
• WBVar00119747
• WBVar00119748
• WBVar00119756
• WBVar00119754
• WBVar00119755
• WBVar00119752
• WBVar00119753
• WBVar00119750
• WBVar00119751
• WBVar00119745
• WBVar00119746
• WBVar00119743
• WBVar00119744
• WBVar00119741
• WBVar00119742
• WBVar00119740
• WBVar00015162
• WBVar00015157

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051768
• Remark: Cbr-dyf-14, AAGACGCCAACTATTCCCATAAGCGGAAACTTCTAGAATCCCAAATCCAACTGCTCCGCG, WBGene00034196
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term