WormMine: Gene WBGene00033905

• WormBase Gene ID: WBGene00033905
• Gene Name: CBG13076
• Sequence Name: CBG13076
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Transactive response DNA-binding protein N-terminal domain and TAR DNA-binding protein 43, N-terminal. Is an ortholog of C. elegans C27H5.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13076b.1	CBG13076b.1		[unknown]
Transcript:CBG13076a.1	CBG13076a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13076b	CBG13076b		[unknown]
CDS:CBG13076a	CBG13076a		[unknown]

0 RNAi Result

7 Allele

• WBVar00119307
• WBVar00119308
• WBVar00119305
• WBVar00119306
• WBVar00119303
• WBVar00119304
• WBVar00119302

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054857
• Remark: CBG13076, TGCGAGAACAACTAGTCCATCTTCAATCAATTCTCGAATCAGCAACCCGCGAAGCAGCTG, WBGene00033905
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term