WormMine: Gene WBGene00033778

• WormBase Gene ID: WBGene00033778
• Gene Name: Cbr-swsn-1
• Sequence Name: CBG12912
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SMARCC, SWIRM-associated domain; SWI/SNF complex subunit SMARCC2; SANT/Myb domain; SWIRM-associated domain at the C-terminal; SWIRM-associated region 1; SWIRM domain; Winged helix-like DNA-binding domain superfamily; Myb-like DNA-binding domain; Homeobox-like domain superfamily; and SMARCC, C-terminal. Is an ortholog of C. elegans swsn-1. In C. elegans, swsn-1 is involved in several processes, including determination of adult lifespan; negative regulation of vulval development; and positive regulation of growth rate.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12912.1	CBG12912.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12912	CBG12912		[unknown]

0 RNAi Result

16 Allele

• WBVar00119109
• WBVar00119110
• WBVar00119111
• WBVar00119112
• WBVar00119100
• WBVar00119107
• WBVar00119108
• WBVar00119105
• WBVar00119106
• WBVar00119103
• WBVar00119104
• WBVar00119101
• WBVar00119102
• WBVar00119099
• WBVar00119097
• WBVar00119098

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054865
• Remark: Cbr-psa-1, GCGTTCCATATGGATCAATTGAAGTATTTGGAGAATCGTGCCAAGCACGAGGCGCATACA, WBGene00033778
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term