WormMine: Gene WBGene00038509

• WormBase Gene ID: WBGene00038509
• Gene Name: Cbr-ucp-4
• Sequence Name: CBG19253
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Mitochondrial substrate/solute carrier; Mitochondrial carrier domain superfamily; and Mitochondrial carrier protein. Is an ortholog of C. elegans ucp-4. In C. elegans, ucp-4 is involved in response to cold.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19253.1	CBG19253.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19253	CBG19253		[unknown]

0 RNAi Result

5 Allele

• WBVar00057099
• WBVar00127325
• WBVar00127324
• WBVar00127323
• WBVar00127322

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1057976
• Remark: Cbr-ucp-4, ACGTCGATCTCTACAACGGTGTCATCGACTGCTACATCAAAATCATTCGAAATGAAGGAT, WBGene00038509
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term