WormMine: Gene WBGene00038525

• WormBase Gene ID: WBGene00038525
• Gene Name: CBG19278
• Sequence Name: CBG19278
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-62.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19278b.1	CBG19278b.1		[unknown]
Transcript:CBG19278a.1	CBG19278a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19278a	CBG19278a		[unknown]
CDS:CBG19278b	CBG19278b		[unknown]

0 RNAi Result

18 Allele

• WBVar00057159
• WBVar00057164
• WBVar00057149
• WBVar00057154
• WBVar00057179
• WBVar00057169
• WBVar00057174
• WBVar00057139
• WBVar00057144
• WBVar00057124
• WBVar00057129
• WBVar00057134
• WBVar00127354
• WBVar00127353
• WBVar00127352
• WBVar00127357
• WBVar00127356
• WBVar00127355

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069059
• Remark: CBG19278, CAAGACTGTATGGAGCAGCTGCGTATTCACGTTGACAAGAGTCTTCAGGCGAAGAAATTG, WBGene00038525
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term