WormMine: Gene WBGene00024733

• WormBase Gene ID: WBGene00024733
• Gene Name: CBG01508
• Sequence Name: CBG01508
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans C32B5.15 and C39B5.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01508.1	CBG01508.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01508	CBG01508		[unknown]

0 RNAi Result

36 Allele

• WBVar00068441
• WBVar00068576
• WBVar00068541
• WBVar00068556
• WBVar00068526
• WBVar00068561
• WBVar00068531
• WBVar00068546
• WBVar00068551
• WBVar00068536
• WBVar00068411
• WBVar00068476
• WBVar00068481
• WBVar00068416
• WBVar00068421
• WBVar00068486
• WBVar00068491
• WBVar00068426
• WBVar00068431
• WBVar00068496
• WBVar00068501
• WBVar00068436
• WBVar00068566
• WBVar00068571
• WBVar00068506
• WBVar00068511
• WBVar00068446
• WBVar00068451
• WBVar00068516
• WBVar00068521

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053632
• Remark: CBG01508, GAATTTGAGGAATACGATCCGAATGAACCAGAGAAGAGACCAAGGGAGTACGTTCTTGAT, WBGene00024733
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term