WormMine: Gene WBGene00024191

• WormBase Gene ID: WBGene00024191
• Gene Name: Cbr-phg-1
• Sequence Name: CBG00864
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: GDNF/GAS1. Is an ortholog of C. elegans phg-1. In C. elegans, phg-1 is involved in negative regulation of cell cycle G1/S phase transition.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00864.1	CBG00864.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00864	CBG00864		[unknown]

0 RNAi Result

11 Allele

• WBVar00064763
• WBVar00064748
• WBVar00064733
• WBVar00064768
• WBVar00064753
• WBVar00064738
• WBVar00064723
• WBVar00064773
• WBVar00064758
• WBVar00064743
• WBVar00064728

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069332
• Remark: Cbr-phg-1, TGCAAAACCCTTCTGAATCAGACAATCGAAACTTCCGTCGGAGCAATTTTCTCGAATTGC, WBGene00024191
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term