WormMine: Gene WBGene00024202

• WormBase Gene ID: WBGene00024202
• Gene Name: Cbr-acs-7
• Sequence Name: CBG00883
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme; AMP-binding enzyme, C-terminal domain; AMP-binding enzyme C-terminal domain; and ANL, N-terminal domain. Is an ortholog of C. elegans acs-7. In C. elegans, acs-7 is involved in ascaroside biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00883.1	CBG00883.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00883	CBG00883		[unknown]

0 RNAi Result

2 Allele

• WBVar00065098
• WBVar00065093

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052833
• Remark: CBG00883, AAACTGGCTCGCTACAAGCACATCAAGGAAATCGAGTTCGTCGGCGAAATTCTGCGCACT, WBGene00024202
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term