WormMine: Gene WBGene00023791

• WormBase Gene ID: WBGene00023791
• Gene Name: CBG00399
• Sequence Name: CBG00399
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Lectin C-type domain; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans clec-198.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00399.1	CBG00399.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00399	CBG00399		[unknown]

0 RNAi Result

18 Allele

• WBVar00062138
• WBVar00062108
• WBVar00062173
• WBVar00062143
• WBVar00062113
• WBVar00062148
• WBVar00062118
• WBVar00062088
• WBVar00062153
• WBVar00062123
• WBVar00062093
• WBVar00062158
• WBVar00062128
• WBVar00062098
• WBVar00062163
• WBVar00062133
• WBVar00062103
• WBVar00062168

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069168
• Remark: CBG00399, GAATACGATGAATTGCACTATATTGATGGATACGTAGCTGGACAGTGGGATGATATGATA, WBGene00023791
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term