WormMine: Gene WBGene00023908

• WormBase Gene ID: WBGene00023908
• Gene Name: Cbr-sptf-2
• Sequence Name: CBG00532
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans sptf-2. In C. elegans, sptf-2 is involved in canonical Wnt signaling pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00532.1	CBG00532.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00532	CBG00532		[unknown]

0 RNAi Result

2 Allele

• WBVar00063243
• WBVar00063248

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055974
• Remark: Cbr-sptf-2, TTTGTGATTGGTTTGAATGTGGAAAACGATTCGATCGAAGTGATCAACTGATTAGACACA, WBGene00023908
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term