WormMine: Gene WBGene00026248

• WormBase Gene ID: WBGene00026248
• Gene Name: CBG03378
• Sequence Name: CBG03378
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Nuclear hormone receptor-like domain superfamily; Ligand-binding domain of nuclear hormone receptor; and Nuclear hormone receptor, ligand-binding domain. Is an ortholog of C. elegans Y67D8B.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03378.1	CBG03378.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03378	CBG03378		[unknown]

0 RNAi Result

2 Allele

• WBVar00011744
• WBVar00011749

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050185
• Remark: CBG03378, AATGGTGGAGAGCAACTACGGTGGAATGCGTGGAACTCTGCAACAACAAATTCACACTGA, WBGene00026248
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term