WormMine: Gene WBGene00032334

• WormBase Gene ID: WBGene00032334
• Gene Name: Cbr-aff-1
• Sequence Name: CBG11169
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Cell-cell fusogen EFF/AFF, domain 3; Type I membrane glycoproteins cell-cell fusogen; and Cell-cell fusogen EFF/AFF. Is an ortholog of C. elegans aff-1. In C. elegans, aff-1 is involved in regulation of egg-laying behavior and syncytium formation by plasma membrane fusion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11169.1	CBG11169.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11169	CBG11169		[unknown]

0 RNAi Result

3 Allele

• WBVar00012847
• WBVar00012857
• WBVar00012852

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059600
• Remark: Cbr-aff-1, GAATCCATATTGTCATAGCTGTTGGGCTACTGTTCCTTCTTATCATTCTCTTCACAAAAT, WBGene00032334
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term