WormMine: Gene WBGene00035612

• WormBase Gene ID: WBGene00035612
• Gene Name: Cbr-pod-1
• Sequence Name: CBG15309
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Anaphase-promoting complex subunit 4, WD40 domain; Coronin; Domain of unknown function DUF1899; Type of WD40 repeat; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; Coronin 7; Quinoprotein alcohol dehydrogenase-like superfamily; Domain of unknown function (DUF1899); and Anaphase-promoting complex subunit 4 WD40 domain. Is an ortholog of C. elegans pod-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15309d.2	CBG15309d.2		[unknown]
Transcript:CBG15309d.1	CBG15309d.1		[unknown]
Transcript:CBG15309a.1	CBG15309a.1		[unknown]
Transcript:CBG15309b.1	CBG15309b.1		[unknown]
Transcript:CBG15309c.1	CBG15309c.1		[unknown]
Transcript:CBG15309c.2	CBG15309c.2		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15309d	CBG15309d		[unknown]
CDS:CBG15309a	CBG15309a		[unknown]
CDS:CBG15309b	CBG15309b		[unknown]
CDS:CBG15309c	CBG15309c		[unknown]

0 RNAi Result

2 Allele

• WBVar00013649
• WBVar00013644

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065591
• Remark: Cbr-pod-1, GTTGGCTCCGTTTATGTCCCCAGTTGGAAGTCAAGGAATCGCTTTCCATCATAAGATTAA, WBGene00035612
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term