WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032776 Gene Name  Cbr-ani-1
Sequence Name  ? CBG11691 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Pleckstrin homology domain; PH domain; Anillin homology domain; Cell division protein anillin; and PH-like domain superfamily. Is an ortholog of C. elegans ani-1. In C. elegans, ani-1 is involved in several processes, including cytoskeleton organization; first cell cycle pseudocleavage; and nematode male tail tip morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11691b.1 CBG11691b.1   [unknown]
Transcript:CBG11691a.1 CBG11691a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11691b CBG11691b   [unknown]
CDS:CBG11691a CBG11691a   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00013552

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ani-1, CTTCAGAAGTGGTTATCAGTTATCAATACGACGTCCCGACAGCTGTGTACATGGAGAAAT, WBGene00032776   Expr1066868 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term