WormMine: Gene WBGene00033808

• WormBase Gene ID: WBGene00033808
• Gene Name: Cbr-nlp-77
• Sequence Name: CBG12955
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SXP/RAL-2 family protein Ani s 5-like, metal-binding domain and SXP/RAL-2 family protein Ani s 5-like, cation-binding domain. Is an ortholog of C. elegans nlp-77.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12955.1	CBG12955.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12955	CBG12955		[unknown]

0 RNAi Result

1 Allele

• WBVar00014862

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061481
• Remark: CBG12955, CAAGCCAAGGGACAAAAGATCCAAGCCTACTTGAATGCCCTCCCAGCCAACGTTAAGGCC, WBGene00033808
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term