WormMine: Gene WBGene00033470

• WormBase Gene ID: WBGene00033470
• Gene Name: Cbr-sec-12
• Sequence Name: CBG12530
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans sec-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12530.1	CBG12530.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12530	CBG12530		[unknown]

0 RNAi Result

1 Allele

• WBVar00014612

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069206
• Remark: CBG12530, AAAAGATAATGTTTGTTGTTGCTACTTATCATTGTGGACGTTCAACGGCGAGAGGAGAGT, WBGene00033470
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term