WormMine: Gene WBGene00032973

• WormBase Gene ID: WBGene00032973
• Gene Name: Cbr-wdr-23
• Sequence Name: CBG11954
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD repeat protein DCAF11/LEC14B; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-23. In C. elegans, wdr-23 is involved in several processes, including determination of adult lifespan; negative regulation of cellular response to manganese ion; and negative regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11954d.1	CBG11954d.1		[unknown]
Transcript:CBG11954c.1	CBG11954c.1		[unknown]
Transcript:CBG11954b.1	CBG11954b.1		[unknown]
Transcript:CBG11954a.1	CBG11954a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11954d	CBG11954d		[unknown]
CDS:CBG11954c	CBG11954c		[unknown]
CDS:CBG11954b	CBG11954b		[unknown]
CDS:CBG11954a	CBG11954a		[unknown]

0 RNAi Result

2 Allele

• WBVar00014237
• WBVar00014232

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1057191
• Remark: Cbr-wdr-23, AAGGCGTTATTGCTCCATACGACCATCCAAATATTCACCAATTCGGCGACGAAGATTCAT, WBGene00032973
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term