WormMine: Gene WBGene00034460

• WormBase Gene ID: WBGene00034460
• Gene Name: CBG13748
• Sequence Name: CBG13748
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans F28F8.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13748.1	CBG13748.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13748	CBG13748		[unknown]

0 RNAi Result

24 Allele

• WBVar00015977
• WBVar00015982
• WBVar00015967
• WBVar00015962
• WBVar00015972
• WBVar00015917
• WBVar00015912
• WBVar00015907
• WBVar00015902
• WBVar00015957
• WBVar00015952
• WBVar00015947
• WBVar00015942
• WBVar00015937
• WBVar00015932
• WBVar00015927
• WBVar00015922
• WBVar00015877
• WBVar00015882
• WBVar00015867
• WBVar00015872
• WBVar00015897
• WBVar00015887
• WBVar00015892

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070195
• Remark: CBG13748, TACAAGGTCGTCAGAATCCGGAGAGTCGGAAGCCACGTCATCAGCATCTAAGGCAAACTT, WBGene00034460
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term