WormMine: Gene WBGene00087639

• WormBase Gene ID: WBGene00087639
• Gene Name: CBG26225
• Sequence Name: CBG26225
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Peptidase S1, PA clan; Nematode trypsin-6-like family; and Chymotrypsin family Peptidase-S1. Is an ortholog of C. elegans Y116A8A.4 and Y116A8A.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG26225.1	CBG26225.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG26225	CBG26225		[unknown]

0 RNAi Result

5 Allele

• WBVar00015687
• WBVar00015697
• WBVar00015692
• WBVar00015702
• WBVar00015682

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067968
• Remark: CBG26225, CCGAATGATTTCAAAGTGGAAGTGGAATATGTGAATGAATTGGATGAGAGAGAATTGGAG, WBGene00087639
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term