WormMine: Gene WBGene00034365

• WormBase Gene ID: WBGene00034365
• Gene Name: CBG13624
• Sequence Name: CBG13624
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: WD40 repeat; Tectonin beta-propeller repeat-containing protein 2; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans W09G3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13624.1	CBG13624.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13624	CBG13624		[unknown]

0 RNAi Result

29 Allele

• WBVar00015577
• WBVar00015572
• WBVar00120160
• WBVar00120161
• WBVar00120162
• WBVar00120163
• WBVar00120164
• WBVar00120154
• WBVar00120155
• WBVar00120156
• WBVar00120157
• WBVar00120158
• WBVar00120159
• WBVar00120150
• WBVar00120151
• WBVar00120152
• WBVar00120153
• WBVar00120144
• WBVar00120145
• WBVar00120146
• WBVar00120147
• WBVar00120148
• WBVar00120149
• WBVar00120170
• WBVar00120165
• WBVar00120166
• WBVar00120167
• WBVar00120168
• WBVar00120169

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063181
• Remark: CBG13624, TTCCATAAAATGTGTCTGGCTGGAAGATTCACCACTGGATGCATCGCTTGTCGTGTGAAA, WBGene00034365
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term