WormMine: Gene WBGene00034300

• WormBase Gene ID: WBGene00034300
• Gene Name: Cbr-aass-1
• Sequence Name: CBG13546
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Alanine dehydrogenase/pyridine nucleotide transhydrogenase, N-terminal; Saccharopine dehydrogenase, NADP binding domain; Saccharopine dehydrogenase NADP binding domain; Alanine dehydrogenase/PNT, N-terminal domain; NAD(P)-binding domain superfamily; Alanine dehydrogenase/pyridine nucleotide transhydrogenase, NAD(H)-binding domain; Saccharopine dehydrogenase C-terminal domain; and Saccharopine dehydrogenase-like, C-terminal. Is an ortholog of C. elegans aass-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13546a.1	CBG13546a.1		[unknown]
Transcript:CBG13546b.1	CBG13546b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13546b	CBG13546b		[unknown]
CDS:CBG13546a	CBG13546a		[unknown]

0 RNAi Result

1 Allele

• WBVar00015512

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1055266
• Remark: CBG13546, TCCCATATGGTCCTGAATAACGAAATTCAACGAGCCGGAATCCAACGTCCAATTTTGAAG, WBGene00034300
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term