WormMine: Gene WBGene00035011

• WormBase Gene ID: WBGene00035011
• Gene Name: Cbr-add-1
• Sequence Name: CBG14555
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Class II Aldolase and Adducin N-terminal domain; Class II aldolase/adducin N-terminal; and Class II aldolase/adducin N-terminal domain superfamily. Is an ortholog of C. elegans add-1. In C. elegans, add-1 is involved in actin filament bundle organization; memory; and receptor localization to synapse.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14555c.1	CBG14555c.1		[unknown]
Transcript:CBG14555b.1	CBG14555b.1		[unknown]
Transcript:CBG14555a.1	CBG14555a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14555c	CBG14555c		[unknown]
CDS:CBG14555b	CBG14555b		[unknown]
CDS:CBG14555a	CBG14555a		[unknown]

0 RNAi Result

13 Allele

• WBVar00017597
• WBVar00017622
• WBVar00017612
• WBVar00017617
• WBVar00017602
• WBVar00017607
• WBVar00017657
• WBVar00017652
• WBVar00017647
• WBVar00017642
• WBVar00017637
• WBVar00017632
• WBVar00017627

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063253
• Remark: Cbr-add-1, TCACGCTCAAGTTTATCAACAAATCTATGCACCGAACCCATTCTCCATTGAAACCGATGA, WBGene00035011
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term