WormMine: Gene WBGene00034314

• WormBase Gene ID: WBGene00034314
• Gene Name: CBG13564
• Sequence Name: CBG13564
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domain: Transmembrane glycoprotein. Is an ortholog of C. elegans C34H4.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13564a.1	CBG13564a.1		[unknown]
Transcript:CBG13564b.1	CBG13564b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13564b	CBG13564b		[unknown]
CDS:CBG13564a	CBG13564a		[unknown]

0 RNAi Result

10 Allele

• WBVar00120011
• WBVar00120012
• WBVar00120013
• WBVar00120014
• WBVar00120015
• WBVar00120016
• WBVar00120017
• WBVar00120018
• WBVar00120010
• WBVar00120009

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1065056
• Remark: CBG13564, TTTCCAATGGGGAATTCCCGGGAAGCAAGCCACCAACAATCAGTTTTTTAGGAACCCATT, WBGene00034314
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term