Genomics
2 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG13564a.1 | CBG13564a.1 | [unknown] | |
Transcript:CBG13564b.1 | CBG13564b.1 | [unknown] |
Other
2 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:CBG13564b | CBG13564b | [unknown] | |
CDS:CBG13564a | CBG13564a | [unknown] |
10 Allele
Public Name |
---|
WBVar00120011 |
WBVar00120012 |
WBVar00120013 |
WBVar00120014 |
WBVar00120015 |
WBVar00120016 |
WBVar00120017 |
WBVar00120018 |
WBVar00120010 |
WBVar00120009 |
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_upregulated | |
Virus infection: Santeuil infected at L3 larva stage for 12 hours. | Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264. | edgeR, FDR < 0.05. | WBPaper00051137:Santeuil-virus_upregulated_JU1264 |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG13564, TTTCCAATGGGGAATTCCCGGGAAGCAAGCCACCAACAATCAGTTTTTTAGGAACCCATT, WBGene00034314 | Expr1065056 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |