WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035826 Gene Name  Cbr-smg-6
Sequence Name  ? CBG15668 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide-like helical domain superfamily; PIN domain; PIN-like domain superfamily; DNA/RNA-binding domain, Est1-type; Telomerase activating protein Est1; Est1 DNA/RNA binding domain; and Telomerase activating protein Est1, N-terminal. Is an ortholog of C. elegans smg-6. In C. elegans, smg-6 is involved in embryonic genitalia morphogenesis; nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; and regulatory ncRNA-mediated post-transcriptional gene silencing. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15668b.1 CBG15668b.1   [unknown]
Transcript:CBG15668a.1 CBG15668a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15668b CBG15668b   [unknown]
CDS:CBG15668a CBG15668a   [unknown]

0 RNAi Result

5 Allele

Public Name
WBVar00018952
WBVar00018947
WBVar00018967
WBVar00018962
WBVar00018957

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-smg-6, TCTTACGATCAAAGCCATTGGCAACAATCTACCGTGTCGAGGAATCGCGAATTTCGTTAA, WBGene00035826   Expr1058620 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG15667, AGAATTTGCAGAATTTCGCATCGATGGACTGGAGTAAAGAGGTGGAGAATGAGTTTGCGA, WBGene00035825   Expr1054413 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term