WormMine: Gene WBGene00035326

• WormBase Gene ID: WBGene00035326
• Gene Name: Cbr-clik-3
• Sequence Name: CBG14953
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Calponin repeat and Calponin family repeat. Is an ortholog of C. elegans clik-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14953c.1	CBG14953c.1		[unknown]
Transcript:CBG14953a.1	CBG14953a.1		[unknown]
Transcript:CBG14953b.1	CBG14953b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14953a	CBG14953a		[unknown]
CDS:CBG14953c	CBG14953c		[unknown]
CDS:CBG14953b	CBG14953b		[unknown]

0 RNAi Result

5 Allele

• WBVar00121913
• WBVar00121914
• WBVar00121915
• WBVar00121916
• WBVar00121917

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064213
• Remark: CBG14953, ATTCCCAGAAGAAGCCGCCGATTTCCAGCAACAACCAGTGAATGCCCAACCACAGAATTA, WBGene00035326
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term