WormMine: Gene WBGene00035028

• WormBase Gene ID: WBGene00035028
• Gene Name: Cbr-lfi-1
• Sequence Name: CBG14578
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Ciliary rootlet component, centrosome cohesion. Is an ortholog of C. elegans lfi-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14578a.1	CBG14578a.1		[unknown]
Transcript:CBG14578c.1	CBG14578c.1		[unknown]
Transcript:CBG14578b.1	CBG14578b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14578c	CBG14578c		[unknown]
CDS:CBG14578b	CBG14578b		[unknown]
CDS:CBG14578a	CBG14578a		[unknown]

0 RNAi Result

3 Allele

• WBVar00121529
• WBVar00121530
• WBVar00121531

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068842
• Remark: Cbr-lfi-1, AATCTTCTCCGTCGCCACAATGACGAATTGGATACCACCATCAAGGGACATCAAGGAAAA, WBGene00035028
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term