WormMine: Gene WBGene00034992

• WormBase Gene ID: WBGene00034992
• Gene Name: Cbr-glit-1
• Sequence Name: CBG14528
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Carboxylesterase family; Carboxylesterase, type B; and Alpha/Beta hydrolase fold. Is an ortholog of C. elegans glit-1. In C. elegans, glit-1 is involved in cellular response to paraquat and negative regulation of response to oxidative stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14528.1	CBG14528.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14528	CBG14528		[unknown]

0 RNAi Result

10 Allele

• WBVar00121480
• WBVar00121481
• WBVar00121474
• WBVar00121475
• WBVar00121476
• WBVar00121477
• WBVar00121478
• WBVar00121479
• WBVar00121472
• WBVar00121473

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052361
• Remark: Cbr-glit-1, CAACAACACTATAAAGCTTGGACGTTACGTTGGTTGTTCTGAAACCGTCCCACAGAATGT, WBGene00034992
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term