WormMine: Gene WBGene00037859

• WormBase Gene ID: WBGene00037859
• Gene Name: CBG18437
• Sequence Name: CBG18437
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: PHD-finger; Zinc finger, PHD-type; Zinc finger, PHD-finger; Zinc finger, RING/FYVE/PHD-type; SPK domain; Domain of unknown function (DUF545); and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans C16A11.3 and C16A11.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18437.1	CBG18437.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18437	CBG18437		[unknown]

0 RNAi Result

15 Allele

• WBVar00017854
• WBVar00017859
• WBVar00126380
• WBVar00126370
• WBVar00126371
• WBVar00126374
• WBVar00126375
• WBVar00126372
• WBVar00126373
• WBVar00126378
• WBVar00126379
• WBVar00126376
• WBVar00126377
• WBVar00126369
• WBVar00126368

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1053767
• Remark: CBG18437, ACTCAAAACGAGCGCTGAAATCGAACTGGACACCCTCCACCGTATCACTCACTACAAATC, WBGene00037859
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term