WormMine: Gene WBGene00035834

• WormBase Gene ID: WBGene00035834
• Gene Name: CBG15682
• Sequence Name: CBG15682
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat domain superfamily; Leucine-rich repeat, cysteine-containing subtype; and ATP synthase subunit s, mitochondrial. Is an ortholog of C. elegans Y53G8AR.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15682.1	CBG15682.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15682	CBG15682		[unknown]

0 RNAi Result

14 Allele

• WBVar00122911
• WBVar00122913
• WBVar00122912
• WBVar00122915
• WBVar00122914
• WBVar00122917
• WBVar00122916
• WBVar00122919
• WBVar00122918
• WBVar00122920
• WBVar00122922
• WBVar00122921
• WBVar00122924
• WBVar00122923

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061835
• Remark: CBG15682, CTGGAATTTGAGAAAATCAACGCGCTCAGCGGCGGCAAACTTCGGCATCTGTTAGTAGGA, WBGene00035834
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term