WormMine: Gene WBGene00035981

• WormBase Gene ID: WBGene00035981
• Gene Name: CBG15867
• Sequence Name: CBG15867
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domain: SET domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15867.1	CBG15867.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15867	CBG15867		[unknown]

0 RNAi Result

17 Allele

• WBVar00123380
• WBVar00123377
• WBVar00123370
• WBVar00123372
• WBVar00123371
• WBVar00123374
• WBVar00123373
• WBVar00123376
• WBVar00123375
• WBVar00123367
• WBVar00123366
• WBVar00123369
• WBVar00123368
• WBVar00123363
• WBVar00123362
• WBVar00123365
• WBVar00123364

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1058348
• Remark: CBG15867, AAATACGTGAAATGCGAACTTTGTCATCTGTACGCGACACATCGAAGAACGGATCTCATC, WBGene00035981
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term