WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037708 Gene Name  Cbr-dhc-4
Sequence Name  ? CBG18257 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-htz-1 and Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Dynein heavy chain, N-terminal region 2; P-loop containing nucleoside triphosphate hydrolase; Dynein heavy chain, linker; Dynein heavy chain, domain 2, N-terminal; Dynein heavy chain, AAA module D4; and P-loop containing dynein motor region D4. Is an ortholog of C. elegans dhc-4. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18257.1 CBG18257.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18257 CBG18257   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00126136

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-htz-1(gu167) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-htz-1(gu167)_upregulated
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG18257, CAAGCGCTTCGGAAAGTTCTAGAAGCAAGGATTTTTGATGCCCTTCATGTGATGTTTCTT, WBGene00037708   Expr1068408 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG18260, TCTGTTATCAGAATAAACCACTCGAGTTGCCAGAAGATATTCTATTTGTTTTCGTTGCGA, WBGene00037711   Expr1055020 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term