WormMine: Gene WBGene00037357

• WormBase Gene ID: WBGene00037357
• Gene Name: Cbr-clec-50
• Sequence Name: CBG17839
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Lectin C-type domain; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans clec-50.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17839.1	CBG17839.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17839	CBG17839		[unknown]

0 RNAi Result

21 Allele

• WBVar00125872
• WBVar00125870
• WBVar00125871
• WBVar00125865
• WBVar00125866
• WBVar00125863
• WBVar00125864
• WBVar00125869
• WBVar00125867
• WBVar00125868
• WBVar00125861
• WBVar00125862
• WBVar00125860
• WBVar00125855
• WBVar00125858
• WBVar00125859
• WBVar00125856
• WBVar00125857
• WBVar00024357
• WBVar00024362
• WBVar00024367

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063080
• Remark: Cbr-clec-50, GAGGCGTGCAACACCGTAATGAGAGCCTATGTCTGCAAGAAAAGATCCATCCATGCGTAG, WBGene00037357
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term