WormMine: Gene WBGene00038674

• WormBase Gene ID: WBGene00038674
• Gene Name: CBG19464
• Sequence Name: CBG19464
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Putative pyroglutamyl peptidase PgaPase_1; Peptidase C15, pyroglutamyl peptidase I-like; Peptidase C15, pyroglutamyl peptidase I-like superfamily; and Putative pyroglutamyl peptidase 1. Is an ortholog of C. elegans M04C9.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19464.1	CBG19464.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19464	CBG19464		[unknown]

0 RNAi Result

14 Allele

• WBVar00127505
• WBVar00127504
• WBVar00127503
• WBVar00127502
• WBVar00127501
• WBVar00127500
• WBVar00127493
• WBVar00127492
• WBVar00127497
• WBVar00127496
• WBVar00127495
• WBVar00127494
• WBVar00127499
• WBVar00127498

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062862
• Remark: CBG19464, GTTATCTATACTATCTCTCAATTCGTGAGGGCCCCGTCAACACCTTATTCATCCATGTGC, WBGene00038674
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term