WormMine: Gene WBGene00038221

• WormBase Gene ID: WBGene00038221
• Gene Name: Cbr-bcl-11
• Sequence Name: CBG18919
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans bcl-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18919b.1	CBG18919b.1		[unknown]
Transcript:CBG18919a.1	CBG18919a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18919a	CBG18919a		[unknown]
CDS:CBG18919b	CBG18919b		[unknown]

0 RNAi Result

14 Allele

• WBVar00127093
• WBVar00127092
• WBVar00127091
• WBVar00127090
• WBVar00127082
• WBVar00127081
• WBVar00127080
• WBVar00127086
• WBVar00127085
• WBVar00127084
• WBVar00127083
• WBVar00127089
• WBVar00127088
• WBVar00127087

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052236
• Remark: CBG18919, CGAAAAGCACATGAGAAAGTGTGTGGTGAATACCCAAGGAGGGCGTCGTGAAGGAGCATC, WBGene00038221
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term