WormMine: Gene WBGene00039439

• WormBase Gene ID: WBGene00039439
• Gene Name: Cbr-mks-6
• Sequence Name: CBG20463
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C2 domain; CC2D2A N-terminal C2 domain; C2 domain superfamily; and CC2D2A, N-terminal, C2 domain. Is an ortholog of C. elegans mks-6. In C. elegans, mks-6 is involved in non-motile cilium assembly and protein localization to ciliary transition zone.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20463.1	CBG20463.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20463	CBG20463		[unknown]

0 RNAi Result

1 Allele

• WBVar00128691

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058042
• Remark: CBG20463, GAATGTCGTCGACTTTTTTGCGCATGTTATTCAAATTGACGTAGCCTTGGCAGTTTTGAA, WBGene00039439
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term