WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00039243 Gene Name  Cbr-unc-79
Sequence Name  ? CBG20202 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: UNC79; Armadillo-type fold; and Cation-channel complex subunit UNC-79. Is an ortholog of C. elegans unc-79. In C. elegans, unc-79 is involved in several processes, including response to anesthetic; response to ethanol; and response to toluene. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG20202.1 CBG20202.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG20202 CBG20202   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00128281
WBVar00028637

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-unc-79, GCTACAAGATTTCCCAAGTGGAACTTCAAACATCAGCTGCATCGCCTTACTACACTGTCT, WBGene00039245   Expr1057693 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-unc-79.2, TCCAAACCCAAACAATGTGCGTCGCCCAAGCCTGTGAACAAGAGGAAGAAGTCGAGGAGT, WBGene00039243   Expr1060681 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-unc-79.1, TCATTTTATCGCTTCGCTACACGATCCGAATCCATCAGTGGCTCAAAGAGCAATCATTGC, WBGene00039244   Expr1067227 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term